Stem-loop sequence api-mir-137

AccessionMI0013352 (change log)
DescriptionAcyrthosiphon pisum miR-137 stem-loop
Gene family MIPF0000106; mir-137
Literature search

1 open access papers mention api-mir-137
(1 sentences)

Stem-loop 
   a     g ug  cc  c       ug  ac      cauau 
5'  acuug u  gc  cg guauucu  gg  auaaca     u
    ||||| |  ||  || |||||||  ||  ||||||      
3'  ugaac a  ug  gc cauaaga  uc  uauugu     u
   -     - gu  au  a       gu  gu      cagaa
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349951.1: 311432-311513 [+]
intergenic
Database links

Mature sequence api-miR-137

Accession MIMAT0014126
Sequence

52 -  

uauugcuugagaauacacguag

 - 73

Get sequence
Evidence experimental; Illumina [2]

References

1
"Computational Identification of MicroRNA Homologs from Acyrthosiphon pisum (Pea Aphid)" Sathyamurthy G, Swamy NR J. Comp. Intell. Bioinf. 2:109-119(2009).
2
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).