Dead miRNA entry

miRNA accession:
MI0013316
miRNA ID:
csi-MIR166b
Comment:
The sequences previously named csi-MIR166b and csi-MIR166d do not map to MIR166 hairpin-like sequences in the Csi_valencia_1.0 genome assembly. The entries are deleted.

Previous miRNA entry

Stem-loop sequence csi-MIR166b

AccessionMI0013316 (change log)
DescriptionCitrus sinensis miR166b stem-loop
Gene family MIPF0000004; MIR166
Stem-loop
   cacgcguccgauuguuugauuuuuuuu      ---uua               uu      cu     g    c     ---uuu  a       uc   cuuucuuucu 
5'                            gagagg      ugguugaugggaaug  guuugg  cgagg ucau uaggu      ca aauuuuc  gga          u
                              ||||||      |||||||||||||||  ||||||  ||||| |||| |||||      || |||||||  |||           
3'                            cucucu      gccaacugcccuuac  cggacc  gcucu agug auccg      gu uuaaaag  ccu          g
   -------------------------uu      uuggca               uu      ag     -    u     uuuauu  a       ga   uuuuauuuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence csi-miR166b

Accession MIMAT0014091
Sequence

151 - 

ucggaccaggcuucauucccgu

 - 172

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).
2
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).