Stem-loop sequence csi-MIR166a

AccessionMI0013315 (change log)
DescriptionCitrus sinensis miR166a stem-loop
Gene family MIPF0000004; MIR166
Literature search

7 open access papers mention csi-MIR166a
(17 sentences)

Stem-loop
   -------     uauuucuu   a        uu      cu   g c        -----------     uu    -uua        -    ca  u    guuucauu 
5'        gaagc        uug ggggaaug  gucugg  cga g cacuaacu           agauc  ugau    aucucagu ugau  ua auuu        u
          |||||        ||| ||||||||  ||||||  ||| | ||||||||           |||||  ||||    |||||||| ||||  || ||||        u
3'        cuucg        aac ccccuuac  cggacc  gcu c gugauuga           ucuag  acua    uagaguua auua  au uaaa        u
   cgucuau     ---uuauu   c        uu      ag   g a        auuaauagaau     uu    ccca        u    --  u    auaccuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr5: 444262-444463 [-]
intergenic
Database links

Mature sequence csi-miR166a-5p

Accession MIMAT0037373
Sequence

20 - 

ggaauguugucuggcucgagg

 - 40

Get sequence
Evidence experimental; Illumina [2]

Mature sequence csi-miR166a-3p

Accession MIMAT0014090
Sequence

161 - 

ucggaccaggcuucauuccccc

 - 182

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).