Stem-loop sequence csi-MIR162

AccessionMI0013314 (change log)
DescriptionCitrus sinensis miR162 stem-loop
Gene family MIPF0000127; MIR162_1
Literature search

1 open access papers mention csi-MIR162
(8 sentences)

Stem-loop
   aaacuguuuacacugaucugugcugcugauaaaucuuaauuuuuuuuuugaauuuuuauuuaacagaa       --a      a u a     g    c    c       ac  ug  caa       u  gaa 
5'                                                                     aauagag   gaguga g c cugga gcag gguu aucgauc  uu  ug   auuuugu gu   a
                                                                       |||||||   |||||| | | ||||| |||| |||| |||||||  ||  ||   ||||||| ||    
3'                                                                     uuaucuc   cucacu c g gaccu cguc ccaa uagcuag  aa  ac   uaaaaca ca   a
   -------------------------------------------------------------------c       aac      - - c     a    u    a       cu  gu  --a       -  aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
JH999183.1: 24505-24704 [+]
intergenic
Database links

Mature sequence csi-miR162-5p

Accession MIMAT0017388
Previous IDscsi-miR162*
Sequence

89 - 

uggaggcagcgguucaucgauc

 - 110

Get sequence
Evidence experimental; Illumina [2-3]

Mature sequence csi-miR162-3p

Accession MIMAT0014088
Previous IDscsi-miR162.5;csi-miR162
Sequence

160 - 

ucgauaaaccucugcauccag

 - 180

Get sequence
Evidence experimental; Illumina [2-3]

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).
2
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
3
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).