Stem-loop sequence crt-MIR171

AccessionMI0013313 (change log)
DescriptionCitrus reticulata miR171 stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

2 open access papers mention crt-MIR171
(11 sentences)

Stem-loop
   aauaugacaggaauaugcaggaugcuggaaucuuguuuccuaucuuuuggggguuaaaaugaagauuguggugaccauu      ga  ga   guaca   g        ug         a     a   u      ua 
5'                                                                                uuggag  ug  ugg     acg gauauugg  cgguucaau agaaa cgg gcucaa  c
                                                                                  ||||||  ||  |||     ||| ||||||||  ||||||||| ||||| ||| ||||||   
3'                                                                                aaucuc  gc  acc     ugc cuauaacc  gccgaguua uuuuu gcc cgaguu  u
   -------------------------------------------------------------------------------      uc  uc   ----g   a        gu         g     c   u      uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence crt-miR171

Accession MIMAT0014087
Sequence

161 - 

ugauugagccgugccaauauc

 - 181

Get sequence
Evidence not experimental

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).