Stem-loop sequence crt-MIR168

AccessionMI0013312 (change log)
DescriptionCitrus reticulata miR168 stem-loop
Gene family MIPF0000081; MIR168
Stem-loop
   ---------------------ag     gg       ua     c          u     a ug   g  uagu       ug -a   uu  gac    a gu   guguu 
5'                        uuacc  cggucuc  auucg uuggugcagg cggga c  auu gc    uuuuuuu  a  auu  uu   agcg g  ggc     g
                          |||||  |||||||  ||||| |||||||||| ||||| |  ||| ||    |||||||  |  |||  ||   |||| |  |||      
3'                        agugg  gccagag  uaagu aacuacguuc gcccu g  uaa cg    aaaaaaa  u  uaa  aa   uugc c  cug     u
   uuccauuuauagguagguuagag     -a       gc     c          c     a gu   g  ---u       gu ag   uu  -au    a ug   guuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence crt-miR168

Accession MIMAT0014086
Sequence

21 - 

ucgcuuggugcaggucgggaa

 - 41

Get sequence
Evidence not experimental

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).