Stem-loop sequence crt-MIR166b

AccessionMI0013311 (change log)
DescriptionCitrus reticulata miR166b stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention crt-MIR166b
(5 sentences)

Stem-loop
   uauauguucucaucuggguuagcuuaggguuuugagagcaggaagccaugaaagucgauggaugggagaaa     --   u           c  uu      cu      -----auua  a            a 
5'                                                                        aauga  uug uucugagggga ug  gucugg  cgaugc         au auaauuauaauu u
                                                                          |||||  ||| ||||||||||| ||  ||||||  ||||||         || ||||||||||||  
3'                                                                        uuacu  aac aagacuucccu ac  cggacc  gcuaug         ua uauuaauauuaa a
   -------------------------------------------------------------------uuug     ua   u           u  uu      ag      ggaaaaaag  c            u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence crt-miR166b

Accession MIMAT0014085
Sequence

161 - 

ucggaccaggcuucauucccuu

 - 182

Get sequence
Evidence not experimental

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).