Stem-loop sequence crt-MIR166a

AccessionMI0013310 (change log)
DescriptionCitrus reticulata miR166a stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention crt-MIR166a
(7 sentences)

Stem-loop
   uucccuucagaaucaaauucauuguuugauuuuuuuu      ---uua               uu      cu     g    c     ---uuu  a       uc   cuuucuuucu 
5'                                      gagagg      ugguugaugggaaug  guuugg  cgagg ucau uaggu      ca aauuuuc  gga          u
                                        ||||||      |||||||||||||||  ||||||  ||||| |||| |||||      || |||||||  |||           
3'                                      cucucu      gccaacugcccuuac  cggacc  gcucu agug auccg      gu uuaaaag  ccu          g
   -----------------------------------uu      uuggca               uu      ag     -    u     uuuauu  a       ga   uuuuauuuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence crt-miR166a

Accession MIMAT0014084
Sequence

161 - 

ucggaccaggcuucauucccgu

 - 182

Get sequence
Evidence not experimental

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).