Stem-loop sequence ccl-MIR167b

AccessionMI0013309 (change log)
DescriptionCitrus clementina miR167b stem-loop
Gene family MIPF0000023; MIR167_1
Stem-loop
   ---------------------------------------------------------------------------------------auu     -    g      u            c        aa        -  ccu 
5'                                                                                           cgugc acua uaguag ugaagcugccag augaucug  cuuuccuu ga   c
                                                                                             ||||| |||| |||||| |||||||||||| ||||||||  |||||||| ||    
3'                                                                                           guacg uggu guuauc acuuugacgguc uacuagac  gaaaggga cu   c
   cuauggacaaagaucccaaaaaguagacgguuuuggaugacccaaacaacucuugcuagaccaccuccucuucuuuaaucccaaagaccg     a    a      c            -        cg        u  cua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccl-miR167b

Accession MIMAT0014083
Sequence

21 - 

ugaagcugccagcaugaucuga

 - 42

Get sequence
Evidence not experimental

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).