Stem-loop sequence csi-MIR398a

AccessionMI0013305 (change log)
DescriptionCitrus sinensis miR398a stem-loop
Gene family MIPF0000107; MIR398
Literature search

3 open access papers mention csi-MIR398a
(8 sentences)

Stem-loop
   ------------------------------------------------------caacagaug    ac        a    a          g      g        uaaauuugauuugcauugcugcugccugcu 
5'                                                                ugaa  cccagagg guga ccugagaaca agggug cguuggcu                              c
                                                                  ||||  |||||||| |||| |||||||||| |||||| ||||||||                              c
3'                                                                acuu  ggguuucc cacu ggacucuugu uuccac gcaaccgg                              u
   acuuagucuucgucgcuuacaaucucguuaacucauugaacuacugugcacgacuaacuguua    aa        c    -          g      -        uguauguuagaaaaacuaaauuacauaccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr7: 1333347-1333571 [+]
intergenic
Database links

Mature sequence csi-miR398a-5p

Accession MIMAT0037372
Sequence

34 - 

agaacagaggguggcguuggcu

 - 55

Get sequence
Evidence experimental; Illumina [2]

Mature sequence csi-miR398a-3p

Accession MIMAT0014079
Sequence

132 - 

uguguucucaggucaccccuu

 - 152

Get sequence
Evidence experimental; Northern [1], Illumina [2]

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).