Stem-loop sequence ccl-MIR396

AccessionMI0013304 (change log)
DescriptionCitrus clementina miR396 stem-loop
Gene family MIPF0000047; MIR396
Stem-loop
   agagugguccuugaaauagccucuuuguaugggcuuccugcuuaauucuuccucucuaacaucgaguguaaaaugaauggaagaucaucaagccacagauaugagaucugaacauuauuauuau         -------      c                   a      cu  u   --  a  a   c     u    c 
5'                                                                                                                             uaaguccug       gucaug uuuuccacagcuuucuuga cuucca  gu ugc  ug uu aua acggc cuug u
                                                                                                                               |||||||||       |||||| ||||||||||||||||||| ||||||  || |||  || || ||| ||||| |||| a
3'                                                                                                                             guuuaggac       cgguac agagggugucgaaagaacu gagggu  cg gcg  ac ag ugu ugccg ggau g
   ----------------------------------------------------------------------------------------------------------------------------         uuccaca      a                   c      ac  c   cc  -  a   a     c    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ccl-miR396

Accession MIMAT0014078
Sequence

143 - 

uuccacagcuuucuugaacuu

 - 163

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).