Stem-loop sequence csi-MIR169a

AccessionMI0013300 (change log)
DescriptionCitrus sinensis miR169a stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

5 open access papers mention csi-MIR169a
(13 sentences)

Stem-loop
   -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------aucaagugcuaccuuauauauagaaagaauaacaa       --aaauug    -        uuau    ag   c  gu  a   ucua   c        a       -ac gc    a 
5'                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   agguugg        gucu aggguuuc    auga  gga ag  ag gga    gag caagaaug cuugccg   g  auug c
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     |||||||        |||| ||||||||    ||||  ||| ||  || |||    ||| |||||||| |||||||   |  ||||  
3'                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   uccaacc        cagg ucucagag    uacu  ucu uc  uc ccu    cuc guucuuac ggacggc   c  uaau c
   cgauacauguuuuaauaauuuuaaaguacuauuacgucuacuccucuccaaggagugaggaacaguuuuaacuacgugcuaauuaauaaaauuaaacaagcuauuaguucgauagauaaggaagcgaggucaagaacguacuugucaccuagcugcucgggcgauaacacacguauuauuuaugucguauuuuagugugagguugguuucuaacacaguagggguuaagauguugacaaacguauuuuccaacauguuuacguuccucuuugcgguuucgagguucuuuuuugaaaauuaauaaagauugaucuaauaacguuuuauauacggugggauuuuauucgaauaguaauucuugucguaacgaauugagacaaccaacauuaucucuaaaacaugacaaguaccuaggccuuuuuaccgaguuccuccucuucagucuuuuuacccccuuuuuauuuuuacacugcgucucgaguaaucuacuuguaucauaguaucuaguggacucuuaucuuucuuaguagaccacgacguaacgac       aacaguca    c        --uc    cu   a  uc  g   -caa   u        c       aua ua    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr4: 2089053-2089802 [-]
intergenic
Database links

Mature sequence csi-miR169a

Accession MIMAT0014074
Sequence

89 - 

gagccaagaaugacuugccga

 - 109

Get sequence
Evidence experimental; Northern [1], Illumina [2]

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).