Stem-loop sequence csi-MIR160a

AccessionMI0013294 (change log)
DescriptionCitrus sinensis miR160a stem-loop
Gene family MIPF0000032; MIR160
Literature search

5 open access papers mention csi-MIR160a
(35 sentences)

Stem-loop
   auuauac     uc        -    -auu      c       cu          ug a   -   a    a 
5'        cuaug  uauauauu uaua    augugc uggcucc  guaugccauu  c gag uca ucga a
          |||||  |||||||| ||||    |||||| |||||||  ||||||||||  | ||| ||| ||||  
3'        gauac  auauauaa augu    uauacg accgagg  uaugcgguag  g cuc ggu agcu c
   ---uaua     cc        u    accu      u       ag          gu c   c   -    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr7: 28083438-28083580 [-]
intergenic
Database links

Mature sequence csi-miR160a-5p

Accession MIMAT0014068
Sequence

34 - 

gccuggcucccuguaugccau

 - 54

Get sequence
Evidence experimental; Northern [1], RACE [1], Illumina [2-3]

Mature sequence csi-miR160a-3p

Accession MIMAT0037370
Sequence

94 - 

gcguaugaggagccaugcaua

 - 114

Get sequence
Evidence experimental; Illumina [3]

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).
2
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
3
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).