![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence csi-MIR160a |
|||||
Accession | MI0013294 (change log) | ||||
Description | Citrus sinensis miR160a stem-loop | ||||
Gene family | MIPF0000032; MIR160 | ||||
Literature search |
![]()
5 open access papers mention csi-MIR160a | ||||
Stem-loop |
auuauac uc - -auu c cu ug a - a a 5' cuaug uauauauu uaua augugc uggcucc guaugccauu c gag uca ucga a ||||| |||||||| |||| |||||| ||||||| |||||||||| | ||| ||| |||| 3' gauac auauauaa augu uauacg accgagg uaugcgguag g cuc ggu agcu c ---uaua cc u accu u ag gu c c - a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence csi-miR160a-5p |
|
Accession | MIMAT0014068 |
Sequence |
34 - gccuggcucccuguaugccau - 54 |
Evidence | experimental; Northern [1], RACE [1], Illumina [2-3] |
Mature sequence csi-miR160a-3p |
|
Accession | MIMAT0037370 |
Sequence |
94 - gcguaugaggagccaugcaua - 114 |
Evidence | experimental; Illumina [3] |
References |
|
1 |
PMID:19585144
"Identification and characterization of 27 conserved microRNAs in citrus"
Planta. 230:671-685(2009).
|
2 |
PMID:20398412
"Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type"
BMC Genomics. 11:246(2010).
|
3 |
PMID:28054378
"MicroRNA annotation of plant genomes - Do it right or not at all"
Bioessays. [Epub prior to print](2017).
|