Stem-loop sequence ssc-mir-324

AccessionMI0013167 (change log)
DescriptionSus scrofa miR-324 stem-loop
Gene family MIPF0000165; mir-324
Literature search

3 open access papers mention ssc-mir-324
(8 sentences)

Stem-loop 
   ---    gc     c   u c   a     u   u  gaag 
5'    cuau  cuccc gca c ccu gggca ugg gu    c
      ||||  ||||| ||| | ||| ||||| ||| ||     
3'    gaug  ggggg cgu g gga cccgu acc ca    u
   ucu    uu     u   c u   c     c   -  gagg
Get sequence
Deep sequencing
42 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr3: 139855128-139855207 [-]
antisense
ENSSSCT00000030141 ; ACADVL-202; intron 12
ENSSSCT00000019531 ; ACADVL-201; intron 12
chr12: 54860462-54860541 [+]
antisense
ENSSSCT00000030141 ; ACADVL-202; intron 12
ENSSSCT00000019531 ; ACADVL-201; intron 12
Database links

Mature sequence ssc-miR-324

Accession MIMAT0013957
Sequence

12 -  

cgcauccccuagggcauuggugu

 - 34

Get sequence
Deep sequencing28 reads, 9 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).