Stem-loop sequence ssc-mir-1307

AccessionMI0013147 (change log)
DescriptionSus scrofa miR-1307 stem-loop
Gene family MIPF0000558; mir-1307
Literature search

3 open access papers mention ssc-mir-1307
(5 sentences)

Stem-loop 
   ------      aucu       -a  u  a   gc   ucuaug 
5'       cuacca    cgaccgg  cc cg ccg  ucg      u
         ||||||    |||||||  || || |||  |||       
3'       gauggu    gcuggcu  gg gc ggc  agc      u
   cggaua      ----       gc  u  -   uc   uaaccg
Get sequence
Deep sequencing
371 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrUScaf3737: 46361-46440 [-]
intergenic
Database links

Mature sequence ssc-miR-1307

Accession MIMAT0013936
Sequence

49 -  

acucggcguggcgucggucgug

 - 70

Get sequence
Deep sequencing272 reads, 13 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).