![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ssc-mir-130b |
|||||
Accession | MI0013136 (change log) | ||||
Description | Sus scrofa miR-130b stem-loop | ||||
Gene family | MIPF0000034; mir-130 | ||||
Literature search |
![]()
7 open access papers mention ssc-mir-130b | ||||
Stem-loop |
c ca cc a guggg a 5' gccug cuga cucuuuc uguugcacu cu cc c ||||| |||| ||||||| ||||||||| || || 3' cggac gacu gggaaag guaacguga ga gg u u ac ua c ----a g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence ssc-miR-130b-5p |
|
Accession | MIMAT0037366 |
Sequence |
12 - acucuuucccuguugcacuacu - 33 |
Deep sequencing | 68 reads, 13 experiments |
Evidence | experimental; Illumina [5] |
Mature sequence ssc-miR-130b-3p |
|
Accession | MIMAT0013922 |
Sequence |
50 - cagugcaaugaugaaagggcau - 71 |
Deep sequencing | 120 reads, 14 experiments |
Evidence | experimental; Illumina [1,3-4], cloned [2] |
References |
|
1 |
PMID:19917043
"MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"
Anim Genet. 41:159-168(2010).
|
2 |
PMID:20180025
"Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"
Mol Biol Rep. 37:3567-3574(2010).
|
3 |
PMID:21312241
"MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing"
J Cell Biochem. 112:1318-1328(2011).
|
4 |
PMID:24499489
"Exploration of microRNAs in porcine milk exosomes"
BMC Genomics. 15:100(2014).
|
5 |
PMID:25230983
"The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing"
J Appl Genet. 56:239-252(2015).
|