![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ssc-mir-181a-2 |
||||||
Accession | MI0013106 (change log) | |||||
Description | Sus scrofa miR-181a-2 stem-loop | |||||
Gene family | MIPF0000007; mir-181 | |||||
Literature search |
![]()
33 open access papers mention ssc-mir-181a-2 | |||||
Stem-loop |
---- a u cu a ggga 5' acuccaagg aca ucaacg gucggug guuu u ||||||||| ||| |||||| ||||||| |||| u 3' ugggguucc ugu aguugc cagccac caaa u uucu a c -- - aaag |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence ssc-miR-181a |
|
Accession | MIMAT0010191 |
Sequence |
10 - aacauucaacgcugucggugaguu - 33 |
Deep sequencing | 86411 reads, 15 experiments |
Evidence | experimental; Illumina [1,3-4], cloned [2] |
References |
|
1 |
PMID:19917043
"MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"
Anim Genet. 41:159-168(2010).
|
2 |
PMID:20180025
"Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"
Mol Biol Rep. 37:3567-3574(2010).
|
3 |
PMID:21312241
"MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing"
J Cell Biochem. 112:1318-1328(2011).
|
4 |
PMID:24499489
"Exploration of microRNAs in porcine milk exosomes"
BMC Genomics. 15:100(2014).
|