Stem-loop sequence ssc-mir-191

AccessionMI0013095 (change log)
DescriptionSus scrofa miR-191 stem-loop
Gene family MIPF0000194; mir-191
Literature search

11 open access papers mention ssc-mir-191
(24 sentences)

Stem-loop 
   --ac      c          c  aa       uu  -  c 
5'     agcggg aacggaaucc aa  gcagcug  gu cu c
       |||||| |||||||||| ||  |||||||  || ||  
3'     ucgucc uugcuuuagg uu  cgucgac  ua ga a
   ucuc      c          -  ca       cu  c  g
Get sequence
Deep sequencing
19198 reads, 2.81e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr13: 34898601-34898680 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-191
ssc-mir-191chr13: 34898601-34898680 [-]
ssc-mir-425chr13: 34898111-34898190 [-]
Database links

Mature sequence ssc-miR-191

Accession MIMAT0013876
Sequence

9 -  

caacggaaucccaaaagcagcug

 - 31

Get sequence
Deep sequencing19164 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).