Stem-loop sequence ssc-mir-128-2

Accession

MI0013094 (change log)

Description

Sus scrofa miR-128-2 stem-loop

Gene family

MIPF0000048; mir-128

Literature search

9 open access papers mention ssc-mir-128-2
(14 sentences)

Stem-loop

   --        a          agg      cc    g gag 
5'   gcaguggg aggggggccg   cacugu  gaga u   u
     |||||||| ||||||||||   ||||||  |||| |    
3'   ugucaucc uuucucuggc   gugaca  cucu g   a
   ug        c          caa      --    g acg 

Deep sequencing

832 reads, 60 reads per million, 15 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Sscrofa10.2; GCA_000003025.4): chr13: 22859191-22859270 [+]
• Overlapping transcripts:

  sense

  ENSSSCT00000021430 ; ssc-mir-128-2.1-201; exon 1

  ENSSSCT00000012305 ; ARPP21-201; intron 18

Database links

• EntrezGene:MIR128-2
• miRBase Tracker:MI0013094

Mature sequence ssc-miR-128

• Accession: MIMAT0002157
• Previous IDs: ssc-miR-128a
• Sequence: 49 - ucacagugaaccggucucuuu - 69
• Deep sequencing: 1386 reads, 15 experiments
• Evidence: experimental; Illumina [1-3]

References

1. PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2. PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3. PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).