Stem-loop sequence ssc-mir-199a-2

Accession

MI0013093 (change log)

Previous IDs

ssc-mir-199a

Description

Sus scrofa miR-199a-2 stem-loop

Gene family

MIPF0000040; mir-199

Literature search

18 open access papers mention ssc-mir-199a-2
(102 sentences)

Stem-loop

   -   c   aac       u        c   ------     g 
5'  ccc gcc   ccagugu cagacuac ugu      ucagg g
    ||| |||   ||||||| |||||||| |||      |||||  
3'  ggg cgg   gguuaca gucugaug aca      agucu g
   c   u   auu       c        -   ugugua     c 

Deep sequencing

46991 reads, 8.43e+03 reads per million, 15 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Sscrofa10.2; GCA_000003025.4): chr2: 69991779-69991858 [-]
• Overlapping transcripts:

  antisense

  ENSSSCT00000014885 ; DNM2-201; intron 13

Database links

• EntrezGene:MIR199A
• miRBase Tracker:MI0013093

Mature sequence ssc-miR-199a-5p

• Accession: MIMAT0013874
• Sequence: 10 - cccaguguucagacuaccuguuc - 32
• Deep sequencing: 28303 reads, 15 experiments
• Evidence: experimental; cloned [1], Illumina [2-3]

Mature sequence ssc-miR-199a-3p

• Accession: MIMAT0013875
• Sequence: 51 - acaguagucugcacauugguua - 72
• Deep sequencing: 68359 reads, 15 experiments
• Evidence: experimental; cloned [1], Illumina [2-4]

References

1. PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2. PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3. PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4. PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).