Stem-loop sequence osa-MIR2871b

AccessionMI0013036 (change log)
DescriptionOryza sativa miR2871b stem-loop
Gene family MIPF0000986; MIR2871
Literature search

2 open access papers mention osa-MIR2871b
(4 sentences)

Stem-loop
            c                       c      aaa       auaucucaagugacuuuguuc 
5' auggcugcc accauggugaccguagaaacuaa auagaa   gagguag                     a
   ||||||||| ||||||||||||||||||||||| ||||||   |||||||                     u
3' uaccgacgg ugguaucacugguaucuuugauu uaucuu   uuccauc                     u
            -                       u      ---       aaugaacagauaagguugcau 
Get sequence
Deep sequencing
89 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 8340799-8340939 [+]
intergenic
Database links

Mature sequence osa-miR2871b-5p

Accession MIMAT0037363
Sequence

13 - 

cauggugaccguagaaacuaacau

 - 36

Get sequence
Deep sequencing67 reads, 2 experiments
Evidence experimental; Illumina [3]

Mature sequence osa-miR2871b-3p

Accession MIMAT0013821
Sequence

106 - 

uauuuuaguuucuauggucac

 - 126

Get sequence
Deep sequencing21 reads, 2 experiments
Evidence experimental; Illumina [1-3]
Database links

References

1
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).
2
PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).
3
PMID:26083154 "MicroRNA-mediated regulation of gene expression in the response of rice plants to fungal elicitors" Baldrich P, Campo S, Wu MT, Liu TT, Hsing YI, San Segundo B RNA Biol. 12:847-863(2015).