Stem-loop sequence eca-mir-374b

AccessionMI0012960 (change log)
DescriptionEquus caballus miR-374b stem-loop
Gene family MIPF0000288; mir-374
Literature search

3 open access papers mention eca-mir-374b
(12 sentences)

Stem-loop
   --  u    ug au             c       c 
5'   ac cgga  g  auaauacaaccug uaagugu c
     || ||||  |  ||||||||||||| |||||||  
3'   ug gccu  u  uauuauguuggac auucacg u
   uc  u    gu ac             u       a 
Get sequence
Deep sequencing
829 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 55435984-55436055 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-374b
eca-mir-374bchrX: 55435984-55436055 [-]
eca-mir-421chrX: 55435819-55435897 [-]
Database links

Mature sequence eca-miR-374b

Accession MIMAT0013214
Sequence

11 - 

auauaauacaaccugcuaagug

 - 32

Get sequence
Deep sequencing71 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).