Stem-loop sequence eca-mir-1912

AccessionMI0012948 (change log)
DescriptionEquus caballus miR-1912 stem-loop
Gene family MIPF0000768; mir-1912
Literature search

1 open access papers mention eca-mir-1912
(1 sentences)

Stem-loop
   ---     gg    g u         gg   u    auuu 
5'    cucua  augu c cauugcaug  cug guau    u
      |||||  |||| | |||||||||  ||| ||||    u
3'    gagau  uaca g gugacgugc  gac caua    a
   uua     aa    a u         ga   c    acuu 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 90706739-90706818 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-1912
eca-mir-1912chrX: 90706739-90706818 [+]
eca-mir-1264chrX: 90707867-90707935 [+]
Database links

Mature sequence eca-miR-1912

Accession MIMAT0013201
Sequence

46 - 

uacccagagcgugcagugugaa

 - 67

Get sequence
Deep sequencing12 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).