Stem-loop sequence eca-mir-376a

AccessionMI0012888 (change log)
DescriptionEquus caballus miR-376a stem-loop
Gene family MIPF0000091; mir-368
Stem-loop
   u    g  a    c    u      guacaaua 
5'  aaaa gu gauu uccu cuauga        u
    |||| || |||| |||| ||||||        u
3'  uuuu ca cuaa agga gauacu        u
   c    g  c    a    -      aauuagua 
Get sequence
Deep sequencing
203 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42912234-42912301 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-376a
eca-mir-1193chr24: 42902577-42902697 [+]
eca-mir-543chr24: 42904247-42904318 [+]
eca-mir-495chr24: 42906084-42906165 [+]
eca-mir-3958chr24: 42908032-42908174 [+]
eca-mir-376cchr24: 42911104-42911169 [+]
eca-mir-376bchr24: 42911856-42911937 [+]
eca-mir-376achr24: 42912234-42912301 [+]
eca-mir-1185chr24: 42914351-42914436 [+]
eca-mir-381chr24: 42916054-42916128 [+]
eca-mir-487bchr24: 42916520-42916603 [+]
eca-mir-539chr24: 42917365-42917442 [+]
eca-mir-889chr24: 42917940-42918017 [+]
eca-mir-544-2chr24: 42918692-42918781 [+]
eca-mir-655chr24: 42919594-42919690 [+]
eca-mir-3959chr24: 42921540-42921650 [+]
eca-mir-487achr24: 42921992-42922071 [+]
Database links

Mature sequence eca-miR-376a

Accession MIMAT0013143
Sequence

44 - 

aucauagaggaaaauccacgu

 - 64

Get sequence
Deep sequencing79 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).