Stem-loop sequence eca-mir-27b

AccessionMI0012865 (change log)
DescriptionEquus caballus miR-27b stem-loop
Gene family MIPF0000036; mir-27
Literature search

2 open access papers mention eca-mir-27b
(3 sentences)

Stem-loop
                     auug        ugac     
5' aggugcagagcuuagcug    gugaacag    uggu 
   ||||||||||||||||||    ||||||||    ||| u
3' uccacgucuugaaucggu    cacuuguu    gccu 
                     --ga        --uc     
Get sequence
Deep sequencing
80941 reads, 5.65e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr23: 2317696-2317768 [-]
sense
ENSECAT00000027645 ; eca-mir-27b-201; exon 1
Clustered miRNAs
< 10kb from eca-mir-27b
eca-mir-23bchr23: 2317924-2317997 [-]
eca-mir-27bchr23: 2317696-2317768 [-]
eca-mir-24-2chr23: 2317177-2317244 [-]
Database links

Mature sequence eca-miR-27b

Accession MIMAT0013114
Sequence

49 - 

uucacaguggcuaaguucugc

 - 69

Get sequence
Deep sequencing80813 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).