Stem-loop sequence eca-mir-138-2

AccessionMI0012824 (change log)
DescriptionEquus caballus miR-138-2 stem-loop
Gene family MIPF0000075; mir-138
Literature search

1 open access papers mention eca-mir-138-2
(2 sentences)

Stem-loop
   ag             uca       gc a 
5'   cugguguugugaa   ggccguu  c a
     |||||||||||||   |||||||  | u
3'   gaccacaacacuu   ucggcaa  g c
   -g             -ca       ga a 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr16: 42248842-42248900 [-]
sense
ENSECAT00000028360 ; eca-mir-138-2-201; exon 1
Database links

Mature sequence eca-miR-138

Accession MIMAT0012925
Sequence

1 - 

agcugguguugugaaucaggccg

 - 23

Get sequence
Deep sequencing60 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).