Stem-loop sequence eca-mir-378

AccessionMI0012812 (change log)
DescriptionEquus caballus miR-378 stem-loop
Gene family MIPF0000168; mir-378
Literature search

1 open access papers mention eca-mir-378
(1 sentences)

Stem-loop
      g  c              ugu      ccu 
5' agg cu cugacuccaggucc   guguua   c
   ||| || ||||||||||||||   ||||||    
3' ucc ga gacugagguucagg   cacgau   g
      g  a              --u      aaa 
Get sequence
Deep sequencing
3448 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr14: 28186796-28186861 [-]
intergenic
Database links

Mature sequence eca-miR-378

Accession MIMAT0013068
Sequence

43 - 

acuggacuuggagucagaagg

 - 63

Get sequence
Deep sequencing3432 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).