Stem-loop sequence eca-mir-146a

Accession

MI0012809 (change log)

Description

Equus caballus miR-146a stem-loop

Gene family

MIPF0000103; mir-146

Literature search

4 open access papers mention eca-mir-146a
(38 sentences)

Stem-loop

       uu            c        --g  u 
5' agcu  gagaacugaauu cauggguu   ug c
   ||||  |||||||||||| ||||||||   ||  
3' ucga  uucuugacuuga guguccag   gc a
       -c            a        acu  g 

Deep sequencing

38184 reads, 2.7e+03 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (EquCab2.0; GCF_000002305.2): chr14: 19243271-19243335 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR146A
• miRBase Tracker:MI0012809

Mature sequence eca-miR-146a

• Accession: MIMAT0013065
• Sequence: 6 - ugagaacugaauuccauggguu - 27
• Deep sequencing: 38182 reads, 1 experiments
• Evidence: not experimental

References

1. PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).