Stem-loop sequence eca-mir-454

AccessionMI0012786 (change log)
DescriptionEquus caballus miR-454 stem-loop
Gene family MIPF0000174; mir-454
Literature search

1 open access papers mention eca-mir-454
(4 sentences)

Stem-loop
             ---         cu     ----   u 
5' agaacccuau   cgauauugu  cugcu    gug a
   ||||||||||   |||||||||  |||||    ||| a
3' uuuugggaua   guuauaacg  gauga    cgc a
             uuc         -u     gucu   u 
Get sequence
Deep sequencing
150 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr11: 33283292-33283360 [-]
sense
ENSECAT00000015691 ; SKA2-201; intron 1
Clustered miRNAs
< 10kb from eca-mir-454
eca-mir-301achr11: 33292426-33292511 [-]
eca-mir-454chr11: 33283292-33283360 [-]
Database links

Mature sequence eca-miR-454

Accession MIMAT0013042
Sequence

44 - 

uagugcaauauugcuuauagggu

 - 66

Get sequence
Deep sequencing133 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).