Stem-loop sequence eca-mir-96

AccessionMI0012702 (change log)
DescriptionEquus caballus miR-96 stem-loop
Gene family MIPF0000072; mir-96
Literature search

1 open access papers mention eca-mir-96
(1 sentences)

Stem-loop
   ugg  g  u        a      uu      ---   uc 
5'    cc au uuggcacu gcacau  uugcuu   gug  u
      || || |||||||| ||||||  ||||||   |||   
3'    gg ua aaccguga cgugua  aacgag   cgc  c
   aaa  g  u        -      cu      ucu   cu 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr4: 84471772-84471849 [-]
sense
ENSECAT00000027227 ; eca-mir-96-201; exon 1
antisense
ENSECAT00000013635 ; NRF1-201; intron 11
Clustered miRNAs
< 10kb from eca-mir-96
eca-mir-183chr4: 84472003-84472071 [-]
eca-mir-96chr4: 84471772-84471849 [-]
eca-mir-182chr4: 84467059-84467133 [-]
Database links

Mature sequence eca-miR-96

Accession MIMAT0012950
Sequence

9 - 

uuuggcacuagcacauuuuugcu

 - 31

Get sequence
Deep sequencing4 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).