Stem-loop sequence bmo-mir-2807a-5

AccessionMI0012395 (change log)
DescriptionBombyx mori miR-2807a-5 stem-loop
Gene family MIPF0000826; mir-2807
Stem-loop
   aaaa    ag c           g          uuu    a  uu 
5'     guua  u aaauuuguaug aguuggaaug   gccu ug  u
       ||||  | ||||||||||| ||||||||||   |||| ||  g
3'     caau  a uuuaaacauac ucgaccuugu   uggg gc  c
   uuuc    gg c           g          uac    g  cc 
Get sequence
Deep sequencing
75 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581691.1: 38121-38215 [+]
intergenic
Database links

Mature sequence bmo-miR-2807a

Accession MIMAT0013716
Sequence

64 - 

uuccagcugcauacaaauuuca

 - 85

Get sequence
Deep sequencing126 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).