Stem-loop sequence bmo-mir-2792

AccessionMI0012365 (change log)
DescriptionBombyx mori miR-2792 stem-loop
Stem-loop
   -uga    -cu    u      c       a   cuuuaa 
5'     acug   gugg aucguu uuuaauc aca      u
       ||||   |||| |||||| ||||||| |||      u
3'     ugac   uacc uagcga agauuag ugu      u
   cgug    auu    u      u       a   aauaag 
Get sequence
Deep sequencing
42 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581721.1: 1233111-1233191 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2792
bmo-mir-2792NW_004581721.1: 1233111-1233191 [+]
bmo-mir-2759NW_004581721.1: 1233366-1233442 [+]
Database links

Mature sequence bmo-miR-2792-5p

Accession MIMAT0013690
Sequence

11 - 

ugguaucguucuuuaaucaaca

 - 32

Get sequence
Deep sequencing10 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence bmo-miR-2792-3p

Accession MIMAT0013691
Sequence

50 - 

uagauuagauagcgauuccauu

 - 71

Get sequence
Deep sequencing32 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).