Stem-loop sequence bmo-mir-2775a

AccessionMI0012333 (change log)
DescriptionBombyx mori miR-2775a stem-loop
Stem-loop
   cau                  a            c    a 
5'    ugugcaccgcgggagaaa guaggacauuuc uccc c
      |||||||||||||||||| |||||||||||| ||||  
3'    acacguggcgcccuuuuu cauccuguagag aggg g
   cau                  -            u    c 
Get sequence
Deep sequencing
173 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581741.1: 701730-701810 [-]
intergenic
Database links

Mature sequence bmo-miR-2775a

Accession MIMAT0013659
Sequence

11 - 

cgcgggagaaaaguaggacauu

 - 32

Get sequence
Deep sequencing118 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).