Stem-loop sequence bmo-mir-2774a-1

AccessionMI0012331 (change log)
DescriptionBombyx mori miR-2774a-1 stem-loop
Gene family MIPF0000829; mir-2774
Literature search

1 open access papers mention bmo-mir-2774a-1
(2 sentences)

Stem-loop
   aa  c   -      u  ccgg          aaua 
5'   ga gau aaggga cg    ucuaccgagc    u
     || ||| |||||| ||    ||||||||||     
3'   cu cua uucccu gc    agguggcucg    c
   ca  u   a      -  uaga          ccca 
Get sequence
Deep sequencing
807 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581715.1: 1230134-1230205 [-]
intergenic
Database links

Mature sequence bmo-miR-2774a

Accession MIMAT0013658
Sequence

43 - 

cucgguggaagaucgucccu

 - 62

Get sequence
Deep sequencing3097 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).