Stem-loop sequence bmo-mir-2764

AccessionMI0012318 (change log)
DescriptionBombyx mori miR-2764 stem-loop
Stem-loop
   caguuc                          cgu    u 
5'       uucuuuaguagcuacaauaucuauga   ugau c
         ||||||||||||||||||||||||||   ||||  
3'       aagaggucauugauguuauagaugcu   auua g
   ucuauu                          -uu    a 
Get sequence
Deep sequencing
29 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581782.1: 662619-662699 [-]
intergenic
Database links

Mature sequence bmo-miR-2764

Accession MIMAT0013639
Sequence

49 - 

uucguagauauuguaguuacugg

 - 71

Get sequence
Deep sequencing29 reads, 2 experiments
Evidence experimental; Illumina [1], SOLID [2]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).