Stem-loop sequence bmo-mir-308

AccessionMI0012296 (change log)
DescriptionBombyx mori miR-308 stem-loop
Gene family MIPF0000171; mir-308
Stem-loop
   --   uu    g  ug       u       a   -  u 
5'   cgu  ccac cg  guauuau cuuguga ugu gu u
     |||  |||| ||  ||||||| ||||||| ||| ||  
3'   gug  ggug gc  cauaaua ggacacu aca cg u
   cu   gc    a  gu       -       a   u  a 
Get sequence
Deep sequencing
51661 reads, 9.17e+03 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582010.1: 8094179-8094254 [-]
intergenic
Database links

Mature sequence bmo-miR-308-5p

Accession MIMAT0013604
Previous IDsbmo-miR-308*
Sequence

11 - 

cgugguauuauucuugugaaugu

 - 33

Get sequence
Deep sequencing611 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]
Database links

Mature sequence bmo-miR-308-3p

Accession MIMAT0013605
Previous IDsbmo-miR-308
Sequence

45 - 

aaucacaggauaauacugcgag

 - 66

Get sequence
Deep sequencing51050 reads, 3 experiments
Evidence experimental; Illumina [1], SOLID [2]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).