Stem-loop sequence dpu-mir-275

AccessionMI0012232 (change log)
DescriptionDaphnia pulex miR-275 stem-loop
Gene family MIPF0000187; mir-275
Literature search

1 open access papers mention dpu-mir-275
(1 sentences)

Stem-loop
   ---auauua   -        c        ga         cc    g   uaa 
5'          cug gccacucc cgugcugc  caggugcuu  ggcu ugu   u
            ||| |||||||| ||||||||  |||||||||  |||| |||    
3'          ggc cggugagg gcgcgaug  guccaugga  cuga gcg   a
   cucuagcaa   u        c        aa         --    -   uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (V1.0; GCA_000187875.1) Overlapping transcripts
GL732526.1: 1790722-1790824 [+]
intergenic
Database links

Mature sequence dpu-miR-275

Accession MIMAT0012651
Sequence

61 - 

ucagguaccugaaguagcgcgcg

 - 83

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).