![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bmo-mir-306a |
||||||||||||
Accession | MI0012201 (change log) | |||||||||||
Previous IDs | bmo-mir-306 | |||||||||||
Description | Bombyx mori miR-306a stem-loop | |||||||||||
Gene family | MIPF0000313; mir-306 | |||||||||||
Literature search |
![]()
2 open access papers mention bmo-mir-306a | |||||||||||
Stem-loop |
cc agac ga c g - c u a -- g 5' gcggg g ggcggg g ccgc cu agguac aggug cucugag ug u ||||| | |||||| | |||| || |||||| ||||| ||||||| || 3' cgccu c ccgccu c ggcg ga uccgug uccgc gagacuc gc g -c -gca ag - g c c c c ug c |
|||||||||||
Deep sequencing |
| |||||||||||
Confidence |
Annotation confidence: high
| |||||||||||
Genome context |
|
|||||||||||
Clustered miRNAs |
|
|||||||||||
Database links |
|
Mature sequence bmo-miR-306a-5p |
|
Accession | MIMAT0012629 |
Previous IDs | bmo-miR-306;bmo-miR-306a |
Sequence |
29 - ucagguacuaggugacucuga - 49 |
Deep sequencing | 287002 reads, 3 experiments |
Evidence | experimental; cloned [1], RT-PCR [1], Illumina [2], SOLID [3] |
Database links |
|
Mature sequence bmo-miR-306a-3p |
|
Accession | MIMAT0015303 |
Previous IDs | bmo-miR-306**;bmo-miR-306a* |
Sequence |
63 - cagagccgccucgugccucag - 83 |
Deep sequencing | 483 reads, 3 experiments |
Evidence | experimental; Illumina [2], SOLID [3] |
Database links |
|
References |
|
1 |
PMID:19699294
"A discovery of novel microRNAs in the silkworm (Bombyx mori) genome"
Genomics. 94:438-444(2009).
|
2 |
PMID:20199675
"MicroRNAs of Bombyx mori identified by Solexa sequencing"
BMC Genomics. 11:148(2010).
|
3 |
PMID:20229201
"Novel microRNAs in silkworm (Bombyx mori)"
Funct Integr Genomics. 10:405-415(2010).
|