Stem-loop sequence bmo-mir-2748

AccessionMI0012199 (change log)
DescriptionBombyx mori miR-2748 stem-loop
Gene family MIPF0000836; mir-2808
Stem-loop
   ucggaaac     ccacuga    au -       -----a       g       
5'         gcgac       gaag  c cggcgag      aaacuca ugggcu 
           |||||       ||||  | |||||||      ||||||| ||||| g
3'         cgcug       cuuc  g gccgcuc      uuugggu aucugu 
   ---gcgaa     -------    cc a       cuacaa       -       
Get sequence
Deep sequencing
521 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582017.1: 5717387-5717480 [-]
intergenic
Database links

Mature sequence bmo-miR-2748

Accession MIMAT0012627
Sequence

26 - 

uccggcgagaaaacucaguggg

 - 47

Get sequence
Deep sequencing130 reads, 3 experiments
Evidence experimental; cloned [1], RT-PCR [1]

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).