Stem-loop sequence bmo-mir-2739

AccessionMI0012188 (change log)
DescriptionBombyx mori miR-2739 stem-loop
Literature search

1 open access papers mention bmo-mir-2739
(1 sentences)

Stem-loop
     ug     c  --gag   u    au         ga gg  a   a  g 
5' gc  caccu gg     aug ggau  uauggugug  g  au gaa cc c
   ||  ||||| ||     ||| ||||  |||||||||  |  || ||| ||  
3' cg  gugga cc     ugc ucug  guaccauac  c  ua uuu gg g
     gu     -  aucaa   -    --         aa uu  a   c  u 
Get sequence
Deep sequencing
115 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582029.1: 1198265-1198362 [+]
intergenic
Database links

Mature sequence bmo-miR-2739

Accession MIMAT0012617
Sequence

13 - 

gagauguggauauuaugguguggagg

 - 38

Get sequence
Deep sequencing111 reads, 3 experiments
Evidence experimental; cloned [1], RT-PCR [1], SOLID [2]
Database links

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).
2
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).