Stem-loop sequence bmo-mir-2731-1

AccessionMI0012179 (change log)
Previous IDsbmo-mir-2731a
DescriptionBombyx mori miR-2731-1 stem-loop
Gene family MIPF0000795; mir-2731
Stem-loop
   aa    -aac     c a  c --a    au      --         a 
5'   accu    agaug g ga c   uggu  guggaa  auaaaagcc c
     ||||    ||||| | || |   ||||  ||||||  |||||||||  
3'   ugga    ucuac c cu g   acca  caccuu  uauuuuugg c
   -g    gccc     a -  a aaa    --      uc         c 
Get sequence
Deep sequencing
386 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581845.1: 71154-71244 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2731-1
bmo-mir-2731-2NW_004581845.1: 72378-72468 [-]
bmo-mir-2731-1NW_004581845.1: 71154-71244 [-]
Database links

Mature sequence bmo-miR-2731

Accession MIMAT0012608
Previous IDsbmo-miR-2731a
Sequence

13 - 

ugcgagaccaugguaugugga

 - 33

Get sequence
Deep sequencing712 reads, 3 experiments
Evidence experimental; cloned [1], RT-PCR [1]
Database links

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).