Stem-loop sequence bmo-mir-2753

AccessionMI0012175 (change log)
DescriptionBombyx mori miR-2753 stem-loop
Stem-loop
   a    ---aag   --cu   cag   ---    gguu     cc        a  g 
5'  acug      ucc    ccg   acc   caga    ccggc  ucuucugu ug a
    ||||      |||    |||   |||   ||||    |||||  |||||||| ||  
3'  uggc      agg    ggu   ugg   guuu    ggucg  agaaggua ac g
   a    cgaaga   uaau   uua   uaa    --au     -a        a  u 
Get sequence
Deep sequencing
694 reads, 33.3 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581779.1: 313283-313387 [-]
intergenic
Database links

Mature sequence bmo-miR-2753

Accession MIMAT0012604
Sequence

52 - 

ucaaauggaagaagcuggua

 - 71

Get sequence
Deep sequencing687 reads, 3 experiments
Evidence experimental; cloned [1]
Database links

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).