Dead miRNA entry

miRNA accession:
MI0012044
miRNA ID:
mtr-MIR2675b
Forward to:
MI0012043
Comment:
Two MIR2675 sequences in miRBase 19 map to the same locus in the Mt3.5.2 genome assembly, so are merged in miRBase 20.

Previous miRNA entry

Stem-loop sequence mtr-MIR2675b

AccessionMI0012044 (change log)
DescriptionMedicago truncatula miR2675b stem-loop
Stem-loop
   acuuucau                   a    -  a        uuuaaaaaggucccugcaaaaauuuuuguuuuugaaaauaaaau 
5'         gaauaugguuuuggucccu caaa au uuuuguuu                                            u
           ||||||||||||||||||| |||| || ||||||||                                             
3'         uuuauaccaaaauuaggga guuu ua ggagcaaa                                            u
   ----cgau                   c    a  c        accaaaaucaggaacauuuuuuuuuaaacaaaaaccaggaacgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mtr-miR2675b

Accession MIMAT0013497
Sequence

137 - 

acgaggcauauuugcagggau

 - 157

Get sequence
Evidence experimental;