Stem-loop sequence mtr-MIR2665

AccessionMI0012019 (change log)
DescriptionMedicago truncatula miR2665 stem-loop
Stem-loop 
   uaugaagaggagugauuucaggucaagaauugauccaauaccaccccucaaugaagaaaauggaa  g  aa   -gg   gg   g 
5'                                                                  ga aa  cua   guc  uuu u
                                                                    || ||  |||   |||  ||| u
3'                                                                  cu uu  gau   uag  aaa g
   ---------------------------------------------------------------ua  g  ag   aua   gg   g
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 16554970-16555082 [-]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2665
mtr-MIR395ochr5: 16556404-16556486 [-]
mtr-MIR2665chr5: 16554970-16555082 [-]
mtr-MIR395kchr5: 16553926-16553997 [+]
Database links

Mature sequence mtr-miR2665

Accession MIMAT0013472
Sequence

13 -  

ugauuucaggucaagaauuga

 - 33

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).