Stem-loop sequence dsi-mir-932

AccessionMI0011757 (change log)
DescriptionDrosophila simulans miR-932 stem-loop
Gene family MIPF0000588; mir-932
Stem-loop
   a   auu    - ug     u    u          a        u  uu 
5'  ggu   gguu u  aaguu ucaa uccguagugc uugcagug gu  a
    |||   |||| |  ||||| |||| |||||||||| |||||||| ||   
3'  cua   ccag a  uucaa gguu aggcgucgcg aacgucau ua  a
   a   cuu    c gu     c    u          -        u  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2L: 6697531-6697630 [+]
intergenic
Database links

Mature sequence dsi-miR-932-5p

Accession MIMAT0012477
Previous IDsdsi-miR-932
Sequence

21 - 

ucaauuccguagugcauugcagu

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dsi-miR-932-3p

Accession MIMAT0012478
Previous IDsdsi-miR-932*
Sequence

60 - 

ugcaagcgcugcggauuuggca

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).