![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bdi-MIR444a |
|
Accession | MI0011558 (change log) |
Previous IDs | bdi-MIR444 |
Description | Brachypodium distachyon miR444a stem-loop |
Gene family | MIPF0000402; MIR444 |
Literature search |
1 open access papers mention bdi-MIR444a |
Stem-loop |
cac uc - a c g a c ug - a 5' gcg cga cu gaggcagcaacu cauaacuu cgg aag u uugg aug u ||| ||| || |||||||||||| |||||||| ||| ||| | |||| ||| g 3' cgu guu ga cuccgucguuga guauugaa gcc uuu a aacc uac a --- -c c a c - a u gu g c |
Confidence |
Annotation confidence: not enough data
|
Database links |
|
Mature sequence bdi-miR444a |
|
Accession | MIMAT0012173 |
Previous IDs | bdi-miR444 |
Sequence |
90 - uugcugccucaagcuugcugc - 110 |
Evidence | experimental; qRT-PCR [1], Illumina [2] |
References |
|
1 |
PMID:19585143
"Conserved microRNAs and their targets in model grass species Brachypodium distachyon"
Planta. 230:659-669(2009).
|
2 |
PMID:24367943
"Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon"
Genome Biol. 14:R145(2013).
|