Stem-loop sequence bta-mir-2431

AccessionMI0011481 (change log)
DescriptionBos taurus miR-2431 stem-loop
Stem-loop
   u     -    a      -u  a   --g     a 
5'  ucagg ucau uaagug  gg guu   gcuag c
    ||||| |||| ||||||  || |||   |||||  
3'  agucc agua guucac  cc cag   ugguc u
   g     c    c      cc  a   uaa     a 
Get sequence
Deep sequencing
276 reads, 3.64 reads per million, 55 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 56831689-56831756 [-]
intergenic
Database links

Mature sequence bta-miR-2431-5p

Accession MIMAT0012001
Previous IDsbta-miR-2431*
Sequence

3 - 

caggucauauaaguguggaguu

 - 24

Get sequence
Deep sequencing81 reads, 34 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence bta-miR-2431-3p

Accession MIMAT0012002
Previous IDsbta-miR-2431
Sequence

45 - 

cacccccacuugcaugacccuga

 - 67

Get sequence
Deep sequencing195 reads, 43 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).