![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-2430 |
|||||
Accession | MI0011480 (change log) | ||||
Description | Bos taurus miR-2430 stem-loop | ||||
Literature search |
2 open access papers mention bta-mir-2430 | ||||
Stem-loop |
acu ug uc c uuu - --- c 5' cugag c gg gg agggg c cggu gug u ||||| | || || ||||| | |||| ||| 3' gacuu g cc cc ucccc g gcca uac u ccc gu uc - --u u acu g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence bta-miR-2430 |
|
Accession | MIMAT0012000 |
Sequence |
8 - ucugggucggcagggguuuccgg - 30 |
Deep sequencing | 2 reads, 2 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:19633723
"Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection"
PLoS One. 4:e6349(2009).
|