Stem-loop sequence bta-mir-2285b-1

AccessionMI0011332 (change log)
DescriptionBos taurus miR-2285b-1 stem-loop
Gene family MIPF0000747; mir-2284
Literature search

11 open access papers mention bta-mir-2285b-1
(15 sentences)

Stem-loop 
                       ca           cu 
5' guuggccgaaaaguucauuc  guuuuucugua  a
   ||||||||||||||||||||  |||||||||||   
3' caaucgguuuuucaagugag  uaaaaggguau  c
                       uc           uc
Get sequence
Deep sequencing
651 reads, 3.03 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 39785119-39785190 [-]
sense
ENSBTAT00000011940 ; FAR1-201; intron 1
Database links

Mature sequence bta-miR-2285b

Accession MIMAT0011833
Sequence

46 -  

aaaaucugagugaacuuuuugg

 - 67

Get sequence
Deep sequencing1368 reads, 66 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).