Stem-loop sequence zma-MIR2275c

Accession

MI0011280 (change log)

Description

Zea mays miR2275c stem-loop

Literature search

10 open access papers mention zma-MIR2275c
(15 sentences)

Stem-loop

     a      uugau   u         ag     -          c       auucauagcuuguucgguuaugucuggaucgaagaggguuggaagguccuuucuaguuaaaauuaaau 
5' ag gagaug     aug gucauuuga  ugagg auuagaggga uugaacc                                                                    a
   || ||||||     ||| |||||||||  ||||| |||||||||| |||||||                                                                     
3' uc cucuac     uac cgguaaauu  acucu uaaucuccuu gacuugg                                                                    g
     -      -----   c         cu     a          u       ggaaaaugaggguuacucucaaacaaaccaguguagaccuauccuccaauuucccuaaguuagagaaa 

Deep sequencing

800 reads, 877 reads per million, 167 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (B73_RefGen_v4; GCA_000005005.6): chr10: 70573557-70573793 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0011280

Mature sequence zma-miR2275c-5p

• Accession: MIMAT0011771
• Sequence: 32 - aggauuagagggacuugaacc - 52
• Deep sequencing: 581 reads, 160 experiments
• Evidence: by similarity; MI0011278

Mature sequence zma-miR2275c-3p

• Accession: MIMAT0011772
• Sequence: 193 - uucaguuuccucuaauaucuca - 214
• Deep sequencing: 3 reads, 1 experiments
• Evidence: experimental; 454 [1]

References

1. PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).